Sec14l5^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sec14l5^em1(IMPC)Bay
• Name: SEC14-like lipid binding 5; endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:6279922
• Gene: Sec14l5 Location: Chr16:4964973-5005135 bp, + strand Genetic Position: Chr16, 2.5 cM
• Alliance: Sec14l5^em1(IMPC)Bay page
• IMPC: Sec14l5 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 Protein and 2 guide sequences CCATAGCGGATGGTAGGTCTGTG, CCTACGAGAAGCGCTTCCCCACC, which resulted in a Inter-exdel deletion. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Sec14l5 Mutation: 24 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)