Gemin6^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gemin6^em1(IMPC)Bay
• Name: gem nuclear organelle associated protein 6; endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:6279925
• Synonyms: Gemin6^-
• Gene: Gemin6 Location: Chr17:80531870-80535926 bp, + strand Genetic Position: Chr17, 50.63 cM, cytoband E3
• Alliance: Gemin6^em1(IMPC)Bay page
• IMPC: Gemin6 gene page

Gemin6^em1(IMPC)Bay/Gemin6^em1(IMPC)Bay mice exhibit embryonic lethality, with embryos recovered at E3.5 as early blastocysts but not at E7.5. Blastocysts hatch from the zona pellucida and form outgrowths in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 Protein and 2 guide sequences TGGTTCTAGATCTGGGCAACTGG, CATTCCTGTCACCGAGCAGGGGG, which resulted in a Inter-exdel deletion. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gemin6 Mutation: 30 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)