Cd320^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cd320^em1(IMPC)Bay
• Name: CD320 antigen; endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:6279931
• Gene: Cd320 Location: Chr17:34062065-34068748 bp, + strand Genetic Position: Chr17, 17.98 cM
• Alliance: Cd320^em1(IMPC)Bay page
• IMPC: Cd320 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 Protein and 2 guide sequences ACCTTCCAGTGTCTTACCAGTGG, CTCATATTGCTACGCCTCCGAGG, which resulted in a Inter-exdel deletion. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cd320 Mutation: 28 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)