Mrpl41^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mrpl41^em1(IMPC)Bay
• Name: mitochondrial ribosomal protein L41; endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:6279932
• Synonyms: Mrpl41^-
• Gene: Mrpl41 Location: Chr2:24864129-24865110 bp, - strand Genetic Position: Chr2, 16.88 cM
• Alliance: Mrpl41^em1(IMPC)Bay page
• IMPC: Mrpl41 gene page

Mrpl41^em1(IMPC)Bay/Mrpl41^em1(IMPC)Bay mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos at E7.5 show severe developmental delay, poorly organized extraembryonic tissues, and abnormal gastrulation.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 Protein and 2 guide sequences CGTTTAAAACACCGCCTGACCGG, CATACTGTACGAGACACTAAAGG, which resulted in a Inter-exdel deletion. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Mrpl41 Mutation: 8 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)