Slc25a48em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Slc25a48em1(IMPC)J |
Name: |
solute carrier family 25, member 48; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6280027 |
Gene: |
Slc25a48 Location: Chr13:56585774-56620180 bp, + strand Genetic Position: Chr13, 30.06 cM
|
Alliance: |
Slc25a48em1(IMPC)J page
|
IMPC: |
Slc25a48 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGACATGGCATGATAGGAGA and TTTGAAGGTGGCTTTGACAG, which resulted in a 1016 bp deletion beginning at Chromosome 13 position 56,450,617 bp and ending after 56,451,632 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000381058 (exon 4) and 757 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 54 and early truncation 4 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
3 reference(s) |
|