Zfp423^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp423^em1(IMPC)J
• Name: zinc finger protein 423; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6280645
• Gene: Zfp423 Location: Chr8:88388438-88686223 bp, - strand Genetic Position: Chr8, 42.29 cM, cytoband C4
• Alliance: Zfp423^em1(IMPC)J page
• IMPC: Zfp423 gene page

Mutation origin

• Strain of Origin: Not Specified
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTGCATGTGTGCTTCCTAG and GCAGCTGGCCAACTGCTGCA, which resulted in a 3279 bp deletion beginning at Chromosome 8 position 87,780,106 bp and ending after 87,783,384 bp (GRCm38/mm10). This mutation deletes all but the first 29 bp of ENSMUSE00001238707 (exon 4) and 93 bp of flanking intronic sequence including the splice donor and is predicted to cause a change of amino acid sequence after residue 111 and early truncation 14 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp423 Mutation: 274 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)