Lurap1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lurap1^em1(IMPC)J
• Name: leucine rich adaptor protein 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6281355
• Gene: Lurap1 Location: Chr4:115993925-116001813 bp, - strand Genetic Position: Chr4, 53.1 cM, cytoband C7
• Alliance: Lurap1^em1(IMPC)J page
• IMPC: Lurap1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTCATTATTTGTCTCCCAA and ACCTCGCTCCCCCAACTGCG, which resulted in a 566 bp deletion beginning at Chromosome 4 position 116,144,128 bp and ending after 116,144,693 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000337750 (exon 1) and 253 bp of flanking intronic sequence including the translation start and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Lurap1 Mutation: 11 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)