Cpxm1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cpxm1^em1(IMPC)Tcp
• Name: carboxypeptidase X, M14 family member 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6281920
• Gene: Cpxm1 Location: Chr2:130232695-130239494 bp, - strand Genetic Position: Chr2, 63.22 cM
• Alliance: Cpxm1^em1(IMPC)Tcp page
• IMPC: Cpxm1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1259 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GGTAGTATTACCGAAGAGGA and ATGCCGTTCTGAGGTCTCTA targeting the 5' side and AGCCCAGCACCCTAATGAAC and ATGCAGCACCTACGCCATGG targeting the 3' side of a critical exon(s). This resulted in a 1226-bp deletion on Chr2 from 130395605 to 130396830 (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cpxm1 Mutation: 32 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)