About   Help   FAQ
Asap1em1(IMPC)Wtsi
Endonuclease-mediated Allele Detail
Summary
Symbol: Asap1em1(IMPC)Wtsi
Name: ArfGAP with SH3 domain, ankyrin repeat and PH domain1; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
MGI ID: MGI:6281937
Gene: Asap1  Location: Chr15:63958706-64254768 bp, - strand  Genetic Position: Chr15, 28.55 cM, cytoband D3
Alliance: Asap1em1(IMPC)Wtsi page
IMPC: Asap1 gene page
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA and 4 guide sequences TACTGAACACGTCCAGAGGCTGG, ACGAGGGCTTCTTCTGAATGTGG, CGGTGAGCCCAGCCTGCTCCAGG, CCTCTGCAGGACTGCGCAGCCTC, which resulted in a Exon Deletion. (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Asap1 Mutation:  60 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/05/2024
MGI 6.24
The Jackson Laboratory