Asap1^{em1(IMPC)Wtsi}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Asap1^{em1(IMPC)Wtsi}
• Name: ArfGAP with SH3 domain, ankyrin repeat and PH domain1; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
• MGI ID: MGI:6281937
• Gene: Asap1 Location: Chr15:63958706-64254768 bp, - strand Genetic Position: Chr15, 28.55 cM, cytoband D3
• Alliance: Asap1^{em1(IMPC)Wtsi} page
• IMPC: Asap1 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA and 4 guide sequences TACTGAACACGTCCAGAGGCTGG, ACGAGGGCTTCTTCTGAATGTGG, CGGTGAGCCCAGCCTGCTCCAGG, CCTCTGCAGGACTGCGCAGCCTC, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Asap1 Mutation: 60 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)