Arhgap10^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Arhgap10^em1(IMPC)Tcp
• Name: Rho GTPase activating protein 10; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6281939
• Gene: Arhgap10 Location: Chr8:77976995-78244582 bp, - strand Genetic Position: Chr8, 36.6 cM, cytoband C2
• Alliance: Arhgap10^em1(IMPC)Tcp page
• IMPC: Arhgap10 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1260 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs with spacer sequences of TAAAAGAGCCATCTACGGGG and GTGTAAAACAGTCAATCGAG targeting the 5' side and CTTCGATCTGAAGAGTCGGG and GCACATCACTAGATAGCATG targeting the 3' side of a critical exon. This resulted in a 5-bp deletion on Chr8: 77413906 to 77413910, a 351-bp deletion on Chr8: 77413460 to 77413810, and a 3-bp deletion Chr8: 77413310 to 77413312 (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Arhgap10 Mutation: 53 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)