Mamdc2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mamdc2^em1(IMPC)J
• Name: MAM domain containing 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6283570
• Gene: Mamdc2 Location: Chr19:23279973-23425806 bp, - strand Genetic Position: Chr19, 18.22 cM
• Alliance: Mamdc2^em1(IMPC)J page
• IMPC: Mamdc2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATGTGTTCTATGCTATATG and CTTGCATTGCATCATCCCAA, which resulted in a 446 bp deletion beginning at Chromosome 19 position 23,378,605 bp and ending after 23,379,050 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000349008 (exon 3) and 174 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 49 and early truncation 13 amino acids later. There is a single bp (T) insertion at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Mamdc2 Mutation: 29 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)