Dipk1c^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dipk1c^em1(IMPC)J
• Name: divergent protein kinase domain 1C; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6283585
• Gene: Dipk1c Location: Chr18:84737361-84758561 bp, + strand Genetic Position: Chr18, 57.53 cM
• Alliance: Dipk1c^em1(IMPC)J page
• IMPC: Dipk1c gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGGAACAGAGGGTCACTGCA and GAGACATCTCACTTCCTTGA, which resulted in a 965 bp deletion beginning at Chromosome 18 position 84,730,001 bp and ending after 84,730,965 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000374665 (exon 3) and 305 bp of flanking intronic sequence including the splice acceptor and translation start and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dipk1c Mutation: 14 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)