Rrbp1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rrbp1^em1(IMPC)J
• Name: ribosome binding protein 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6283589
• Gene: Rrbp1 Location: Chr2:143789315-143853183 bp, - strand Genetic Position: Chr2, 70.89 cM
• Alliance: Rrbp1^em1(IMPC)J page
• IMPC: Rrbp1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTCCATCAGTCACAGTCAG and AGGCGGATGGAGAAGTACAG, which resulted in a 2404 bp deletion beginning at Chromosome 2 position 143,988,095 bp and ending after 143,990,498 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000521125 (exon 2) and 285 bp of flanking intronic sequence including the splice acceptor and translation start and is predicted to result in a null allele. There is an 11 bp insertion at the deletion site (TTAGTGCTTAG). (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rrbp1 Mutation: 79 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)