Wdfy1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Wdfy1^em1(IMPC)J
• Name: WD repeat and FYVE domain containing 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6283594
• Gene: Wdfy1 Location: Chr1:79679979-79753764 bp, - strand Genetic Position: Chr1, 40.94 cM, cytoband C4
• Alliance: Wdfy1^em1(IMPC)J page
• IMPC: Wdfy1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAGGACATGACTAATACGG and GGTTTATGATAGCCTGCCAG, which resulted in a 325 bp deletion beginning at Chromosome 1 position 79,739,934 bp and ending after 79,740,258 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001057763 (exon 2) and 257 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 45 and early truncation 20 amino acids later. There is a 10 bp (AATCATCTCA) insertion at the deletion site. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Wdfy1 Mutation: 28 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)