About   Help   FAQ
S100a16em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: S100a16em1(IMPC)J
Name: S100 calcium binding protein A16; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6283645
Gene: S100a16  Location: Chr3:90444561-90450458 bp, + strand  Genetic Position: Chr3, 39.25 cM, cytoband F1-F2
Alliance: S100a16em1(IMPC)J page
IMPC: S100a16 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCCAGGACAAAGATCACCA and GCTGCTTTGTGGTTTTATAT, which resulted in a 1406 bp deletion beginning at Chromosome 3 position 90,541,810 bp and ending after 90,543,215 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000637998 and ENSMUSE00000637995 (exons 2 and 3) and 440 bp of flanking intronic sequence including the splice acceptor translation start and is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any S100a16 Mutation:  15 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory