S100a16^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: S100a16^em1(IMPC)J
• Name: S100 calcium binding protein A16; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6283645
• Gene: S100a16 Location: Chr3:90444561-90450458 bp, + strand Genetic Position: Chr3, 39.25 cM, cytoband F1-F2
• Alliance: S100a16^em1(IMPC)J page
• IMPC: S100a16 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCCAGGACAAAGATCACCA and GCTGCTTTGTGGTTTTATAT, which resulted in a 1406 bp deletion beginning at Chromosome 3 position 90,541,810 bp and ending after 90,543,215 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000637998 and ENSMUSE00000637995 (exons 2 and 3) and 440 bp of flanking intronic sequence including the splice acceptor translation start and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any S100a16 Mutation: 15 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)