Nkpd1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nkpd1^em1(IMPC)J
• Name: NTPase, KAP family P-loop domain containing 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6284319
• Gene: Nkpd1 Location: Chr7:19251763-19258981 bp, + strand Genetic Position: Chr7, 9.92 cM, cytoband A2
• Alliance: Nkpd1^em1(IMPC)J page
• IMPC: Nkpd1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTCCCTGAGAAAGGATGGG and GCTGAAGTTGGCATCCCAGG, which resulted in a 2325 bp deletion beginning at Chromosome 7 position 19,522,850 bp and ending after 19,525,174 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000476801 (exon 4) and 245 bp of flanking intronic sequence including the splice acceptor and is predicted to cause a change of amino acid sequence after residue 224 and early truncation 71 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Nkpd1 Mutation: 32 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)