Uckl1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Uckl1^em1(IMPC)J
• Name: uridine-cytidine kinase 1-like 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6284338
• Gene: Uckl1 Location: Chr2:181210942-181223820 bp, - strand Genetic Position: Chr2, 103.66 cM
• Alliance: Uckl1^em1(IMPC)J page
• IMPC: Uckl1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, GTAAATGCCTAGGATACACC and CTACCCACCACAGTCCACAT, which resulted in a 1225 bp deletion beginning at Chromosome 2 position 181,574,071 bp and ending after 181,575,295 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001277585 and ENSMUSE00001268540 (exons 2 and 5) and 684 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 39 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Uckl1 Mutation: 41 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)