Gbp7^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gbp7^em1(IMPC)J
• Name: guanylate binding protein 7; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6284359
• Gene: Gbp7 Location: Chr3:142236103-142255910 bp, + strand Genetic Position: Chr3, 66.69 cM
• Alliance: Gbp7^em1(IMPC)J page
• IMPC: Gbp7 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATGAATCCTTACAATACAGG and CTTGCAAGCAGCACAGAAGT, which resulted in a 477 bp deletion beginning at Chromosome 3 position 142,536,240 bp where there is a 4 bp retention TGCA after 142,536,490 and then the deletion continues for 227 bp ending after 142,536,720 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001000161 (exon 3) and 349 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acid 64. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gbp7 Mutation: 40 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)