Slc6a16em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Slc6a16em1(IMPC)J |
Name: |
solute carrier family 6, member 16; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6284361 |
Gene: |
Slc6a16 Location: Chr7:44890509-44922791 bp, + strand Genetic Position: Chr7, 29.22 cM
|
Alliance: |
Slc6a16em1(IMPC)J page
|
IMPC: |
Slc6a16 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTGGCCAGTGACGGATGCG and CTAACATTAGAAAGCTCCAG, which resulted in a 1706 bp deletion beginning at Chromosome 7 position 45,259,727 bp and ending after 45,261,432 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001034222 and ENSMUSE00000967546 (exons 4 and 8) and 892 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acids 160.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|