Krtcap2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Krtcap2^em1(IMPC)J
• Name: keratinocyte associated protein 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6284515
• Gene: Krtcap2 Location: Chr3:89153201-89157036 bp, + strand Genetic Position: Chr3, 39.03 cM, cytoband F2
• Alliance: Krtcap2^em1(IMPC)J page
• IMPC: Krtcap2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGCGACCTCCAGGAACCACC and GAAGGGACTATTAACACCAT, which resulted in a 2793 bp deletion beginning at Chromosome 3 position 89,246,442 bp and ending after 89,249,234 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001309950 and ENSMUSE00000310326 (exon 2 and 4) and 2507 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 1 and early truncation 43 amino acids later. There is a 30 bp insertion at the deletion site (TAATAGTCCCTTCCCTTCCCACCATATGCC) (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Krtcap2 Mutation: 21 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)