Cep68^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cep68^em1(IMPC)J
• Name: centrosomal protein 68; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6284517
• Gene: Cep68 Location: Chr11:20177037-20199424 bp, - strand Genetic Position: Chr11, 12.92 cM
• Alliance: Cep68^em1(IMPC)J page
• IMPC: Cep68 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGTCTGTAAATCAAAGCCC and GTTTTCTTCACAAGACTGGG, which resulted in a 2580 bp deletion beginning at Chromosome 11 position 20,238,200 bp and ending after 20,240,779 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000333483 and ENSMUSE00000370638 (exons 3 and 4) and 954 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 104, the loss of 542 amino acids but remains in frame for the final 87 amino acids. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cep68 Mutation: 70 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)