About   Help   FAQ
Ablim2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ablim2em1(IMPC)J
Name: actin-binding LIM protein 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6284829
Gene: Ablim2  Location: Chr5:35915224-36042317 bp, + strand  Genetic Position: Chr5, 18.75 cM, cytoband B2
Alliance: Ablim2em1(IMPC)J page
IMPC: Ablim2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAAGTCCTAGCACCAAGGAG and CCTGGGAGCAGGCAACCATA, which resulted in a 552 bp deletion beginning at Chromosome 5 position 35,841,047 bp and ending after 35,841,598 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000185461 (exon 11) and 431 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 350 and early truncation 37 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ablim2 Mutation:  71 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory