Lman2^{em1(IMPC)Wtsi}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lman2^{em1(IMPC)Wtsi}
• Name: lectin, mannose-binding 2; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
• MGI ID: MGI:6286369
• Gene: Lman2 Location: Chr13:55491646-55510596 bp, - strand Genetic Position: Chr13, 29.8 cM
• Alliance: Lman2^{em1(IMPC)Wtsi} page
• IMPC: Lman2 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Welcome Sanger Institute by injecting CAS9 RNA and 4 guide sequences GAGAGGCCCTCAGAATACCAAGG, CCTGTTCAGTTCCACACCTTACT, AGGCGCACAGTAACCATAGCAGG, CCTCCTCACCTGGTACGAGGCGG, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Lman2 Mutation: 28 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)