About   Help   FAQ
Ergic1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ergic1em1(IMPC)J
Name: endoplasmic reticulum-golgi intermediate compartment 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6294102
Gene: Ergic1  Location: Chr17:26780463-26875908 bp, + strand  Genetic Position: Chr17, 13.34 cM, cytoband B1
Alliance: Ergic1em1(IMPC)J page
IMPC: Ergic1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAGCAGCCCGCTTCTACAG and GCTGGAGTGGAAATTACCAA, which resulted in a 365 bp deletion beginning at Chromosome 17 position 26,629,494 bp and ending after 26,629,858 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001241041 (exon 5) and 240 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 83 and early truncation 26 amino acids later.
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ergic1 Mutation:  130 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory