Shc4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Shc4^em1(IMPC)J
• Name: SHC (Src homology 2 domain containing) family, member 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6294105
• Gene: Shc4 Location: Chr2:125469367-125566068 bp, - strand Genetic Position: Chr2, 61.76 cM
• Alliance: Shc4^em1(IMPC)J page
• IMPC: Shc4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTACCGACTATAAAAATAAG and TTTGGCTCAGTTGGGTCCTA, which resulted in a 519 bp deletion beginning at Chromosome 2 position 125,665,878 bp and ending after 125,666,396 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000325150 (exon 6) and 467 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 298 and early truncation 15 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Shc4 Mutation: 30 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)