Bag2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Bag2^em1(IMPC)J
• Name: BCL2-associated athanogene 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6294108
• Gene: Bag2 Location: Chr1:33784565-33796831 bp, - strand Genetic Position: Chr1, 12.81 cM
• Alliance: Bag2^em1(IMPC)J page
• IMPC: Bag2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTCGGGAAGATGACCACGC and AGCAACTTCAGAGCGAGCAG, which resulted in a 1895 bp deletion beginning at Chromosome 1 position 33,745,386 bp and ending after 33,747,280 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000416750 (exon 3) and 362 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 76 and early truncation 10 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Bag2 Mutation: 25 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)