Wdr73^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Wdr73^em1(IMPC)J
• Name: WD repeat domain 73; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6294116
• Synonyms: Wdr73^-
• Gene: Wdr73 Location: Chr7:80540471-80551017 bp, - strand Genetic Position: Chr7, 45.71 cM, cytoband D2
• Alliance: Wdr73^em1(IMPC)J page
• IMPC: Wdr73 gene page

Wdr73^em1(IMPC)J/Wdr73^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts grown in vitro hatch from the zona pellucida and form irregular outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCATCCATAGTGTAGCAGAC and AGAAGTTCAGGTTTTAGTCG, which resulted in a 482 bp deletion beginning at Chromosome 7 position 80,897,760 bp and ending after 80,898,241 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001266575 (exon 5) and 417 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 96 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Wdr73 Mutation: 32 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)