Wdr73em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Wdr73em1(IMPC)J |
Name: |
WD repeat domain 73; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6294116 |
Synonyms: |
Wdr73- |
Gene: |
Wdr73 Location: Chr7:80540471-80551017 bp, - strand Genetic Position: Chr7, 45.71 cM, cytoband D2
|
Alliance: |
Wdr73em1(IMPC)J page
|
IMPC: |
Wdr73 gene page |
|
Wdr73em1(IMPC)J/Wdr73em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts grown in vitro hatch from the zona pellucida and form irregular outgrowths.
Show the 1 phenotype image(s) involving this allele.
|
|
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCATCCATAGTGTAGCAGAC and AGAAGTTCAGGTTTTAGTCG, which resulted in a 482 bp deletion beginning at Chromosome 7 position 80,897,760 bp and ending after 80,898,241 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001266575 (exon 5) and 417 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 96 and early truncation 2 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
4 reference(s) |
|