U2af1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: U2af1^em1(IMPC)J
• Name: U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6294123
• Gene: U2af1 Location: Chr17:31866055-31877866 bp, - strand Genetic Position: Chr17, 17.02 cM
• Alliance: U2af1^em1(IMPC)J page
• IMPC: U2af1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCCCACTCCTCACTAAAGCC and GTCACTATAGCTGAGCTCGA, which resulted in a 323 bp deletion beginning at Chromosome 17 position 31,648,622 bp and ending after 31,648,944 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000137465 and ENSMUSE00000137461 (exons 4 and 5) and 174 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 66 and early truncation 3 amino acids later. There is a single base pair, A, insertion at the deletion site. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any U2af1 Mutation: 34 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)