About   Help   FAQ
Ltv1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ltv1em1(IMPC)J
Name: LTV1 ribosome biogenesis factor; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6294725
Synonyms: Ltv1-
Gene: Ltv1  Location: Chr10:13054341-13068881 bp, - strand  Genetic Position: Chr10, 4.72 cM
Alliance: Ltv1em1(IMPC)J page
IMPC: Ltv1 gene page
Ltv1em1(IMPC)J/Ltv1em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5, that appear as morula, but no embryos at E7.5. Mutants grown in vitro fail to hatch from the zona pellucida, never forming blastocysts.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGGGTAACCATGTTCTAGT and TATAGCAGTGGAGCCCAGGC, which resulted in a 314 bp deletion beginning at Chromosome 10 position 13,182,791 bp and ending after 13,183,104 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000098234 (exon 5) and 178 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 132 and early truncation 43 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ltv1 Mutation:  19 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory