Ltv1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ltv1^em1(IMPC)J
• Name: LTV1 ribosome biogenesis factor; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6294725
• Synonyms: Ltv1^-
• Gene: Ltv1 Location: Chr10:13054341-13068881 bp, - strand Genetic Position: Chr10, 4.72 cM
• Alliance: Ltv1^em1(IMPC)J page
• IMPC: Ltv1 gene page

Ltv1^em1(IMPC)J/Ltv1^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5, that appear as morula, but no embryos at E7.5. Mutants grown in vitro fail to hatch from the zona pellucida, never forming blastocysts.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGGGTAACCATGTTCTAGT and TATAGCAGTGGAGCCCAGGC, which resulted in a 314 bp deletion beginning at Chromosome 10 position 13,182,791 bp and ending after 13,183,104 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000098234 (exon 5) and 178 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 132 and early truncation 43 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ltv1 Mutation: 19 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)