Kbtbd8^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kbtbd8^em1(IMPC)Tcp
• Name: kelch repeat and BTB (POZ) domain containing 8; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6302753
• Gene: Kbtbd8 Location: Chr6:95094861-95106774 bp, + strand Genetic Position: Chr6, 44.32 cM
• Alliance: Kbtbd8^em1(IMPC)Tcp page
• IMPC: Kbtbd8 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1301 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGGTGGTCCTTCACCTATCA and TCCATCACCTGTAGTTCCCC targeting the 5' side and GAGAAAATCTACGTTTTACA and CATCAAAGGGTTGCATGCCA targeting the 3' side of a critical region. This resulted in a 1446-bp del Chr6: 95121396-95122841 with 24-bp insert at deletion junction (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Kbtbd8 Mutation: 44 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)