Hars2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Hars2^em1(IMPC)J
• Name: histidyl-tRNA synthetase 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6302803
• Synonyms: Hars2^-
• Gene: Hars2 Location: Chr18:36916257-36925615 bp, + strand Genetic Position: Chr18, 19.46 cM
• Alliance: Hars2^em1(IMPC)J page
• IMPC: Hars2 gene page

Hars2^em1(IMPC)J/Hars2^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos are small and form a rudimentary egg-cylinder but no primitive streak or signs of gastrulation are present at E7.5.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTGAATTCAGTAAAGCCCG and TATCATGGCTCTAAAAACCC, which resulted in a 225 bp deletion beginning at Chromosome 18 position 36,788,466 bp and ending after 36,788,690 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001240057 (exon 8) and 131 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 243 and early truncation 24 amino acids later. There is a 4 bp insertion at the deletion site (CTAC). (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Hars2 Mutation: 30 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)