Ssc4d^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ssc4d^em1(IMPC)J
• Name: scavenger receptor cysteine rich family, 4 domains; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6302806
• Gene: Ssc4d Location: Chr5:135989074-136003389 bp, - strand Genetic Position: Chr5, 75.6 cM
• Alliance: Ssc4d^em1(IMPC)J page
• IMPC: Ssc4d gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGACGTTGTAGATGCTAACG and CCTGTGCTGCTAGACAACGT, which resulted in a 4952 bp deletion beginning at Chromosome 5 position 135,962,986 bp and ending after 135,967,937 bp (GRCm38/mm10). This mutation deletes the last 200 bp of exon 4 and all intervening sequence through the first 249 bp of exon 9 (ENSMUSE00000686859 - ENSMUSE00000686851) including the splice acceptors and donors. There is a single bp (T) insertion at the deletion site. This mutation is predicted to cause a change of amino acid sequence after residue 103 and early truncation 62 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ssc4d Mutation: 38 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)