About   Help   FAQ
Papolgem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Papolgem1(IMPC)J
Name: poly(A) polymerase gamma; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6303601
Gene: Papolg  Location: Chr11:23812646-23845253 bp, - strand  Genetic Position: Chr11, 14.37 cM
Alliance: Papolgem1(IMPC)J page
IMPC: Papolg gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTATTAACAGTAGTAAGATA and CAAAAACTAAAGAGAAGACG, which resulted in a 407 bp deletion beginning at Chromosome 11 position 23,885,389 bp and ending after 23,885,795 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001222705 (exon 4) and 325 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 82 and early truncation 13 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Papolg Mutation:  27 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory