Retreg1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Retreg1^em1(IMPC)J
• Name: reticulophagy regulator 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6304302
• Gene: Retreg1 Location: Chr15:25843266-25973773 bp, + strand Genetic Position: Chr15, 9.59 cM
• Alliance: Retreg1^em1(IMPC)J page
• IMPC: Retreg1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Modified isoform(s))
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTTTGTGATACGTACTCAA and TGGATGGCAGGGCAGTGGCG, which resulted in a 268 bp deletion beginning at Chromosome 15 position 25,894,926 bp and ending after 25,895,193 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000649912 (exon 2) and 161 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 90 and early truncation 8 amino acids later. There is a 5 bp (GTATA) insertion at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Retreg1 Mutation: 30 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)