About   Help   FAQ
Zfp512bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp512bem1(IMPC)J
Name: zinc finger protein 512B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6304310
Gene: Zfp512b  Location: Chr2:181223925-181234572 bp, - strand  Genetic Position: Chr2, 103.67 cM
Alliance: Zfp512bem1(IMPC)J page
IMPC: Zfp512b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTGGCACAGGATATATGGA and ATATCACCGACCCCCAAGGG, which resulted in a 295 bp deletion beginning at Chromosome 2 position 181,590,391 bp and ending after 181,590,685 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000170907 (exon 3) and 152 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 41 and early truncation 9 amino acids later. There is an 11 bp insertion (CCAGCCCTCAC) at the deletion site. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp512b Mutation:  43 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory