Zfp512b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp512b^em1(IMPC)J
• Name: zinc finger protein 512B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6304310
• Gene: Zfp512b Location: Chr2:181223925-181234572 bp, - strand Genetic Position: Chr2, 103.67 cM
• Alliance: Zfp512b^em1(IMPC)J page
• IMPC: Zfp512b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTGGCACAGGATATATGGA and ATATCACCGACCCCCAAGGG, which resulted in a 295 bp deletion beginning at Chromosome 2 position 181,590,391 bp and ending after 181,590,685 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000170907 (exon 3) and 152 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 41 and early truncation 9 amino acids later. There is an 11 bp insertion (CCAGCCCTCAC) at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp512b Mutation: 43 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)