Pop7^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pop7^em1(IMPC)J
• Name: processing of precursor 7, ribonuclease P family, (S. cerevisiae); endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6305126
• Gene: Pop7 Location: Chr5:137499701-137500682 bp, - strand Genetic Position: Chr5, 76.51 cM
• Alliance: Pop7^em1(IMPC)J page
• IMPC: Pop7 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTTGATTCCCGTCATACTG and GCGAGACTTGAGGGTTCGCA, which resulted in a 1228 bp deletion beginning at Chromosome 5 position 137,501,323 bp and ending after 137,502,550 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000686426 (exon 1) and 230 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Pop7 Mutation: 11 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)