Zyg11b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zyg11b^em1(IMPC)J
• Name: zyg-ll family member B, cell cycle regulator; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6305141
• Gene: Zyg11b Location: Chr4:108086921-108158293 bp, - strand Genetic Position: Chr4, 50.35 cM
• Alliance: Zyg11b^em1(IMPC)J page
• IMPC: Zyg11b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Insertion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTTCCTTAAGACTTCATTA and AGATTCACTATTAGATACAT, which resulted in a 1055 bp deletion beginning at Chromosome 4 position 108,265,749 bp and ending after 108,266,803 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000601600 (exon 3) and 300 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 22 amino acids later. There is a single bp insertion (G) at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zyg11b Mutation: 34 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)