About   Help   FAQ
Zyg11bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zyg11bem1(IMPC)J
Name: zyg-ll family member B, cell cycle regulator; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6305141
Gene: Zyg11b  Location: Chr4:108086921-108158293 bp, - strand  Genetic Position: Chr4, 50.35 cM
Alliance: Zyg11bem1(IMPC)J page
IMPC: Zyg11b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Insertion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTTCCTTAAGACTTCATTA and AGATTCACTATTAGATACAT, which resulted in a 1055 bp deletion beginning at Chromosome 4 position 108,265,749 bp and ending after 108,266,803 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000601600 (exon 3) and 300 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 22 amino acids later. There is a single bp insertion (G) at the deletion site. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zyg11b Mutation:  34 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory