Znfx1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Znfx1^em1(IMPC)J
• Name: zinc finger, NFX1-type containing 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6305162
• Gene: Znfx1 Location: Chr2:166877713-166904926 bp, - strand Genetic Position: Chr2, 87.22 cM
• Alliance: Znfx1^em1(IMPC)J page
• IMPC: Znfx1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Modified isoform(s))
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTGTGGAGCCTGCTAGAAAG and CTATCTCAACTGGTGCCTCA, which resulted in a 268 bp deletion beginning at Chromosome 2 position 167,048,375 bp and ending after 167,048,642 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000511240 (exon 5) and 119 bp of flanking intronic sequence including the splice acceptor and donor. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Znfx1 Mutation: 106 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)