Cdc5l^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cdc5l^em1(IMPC)J
• Name: cell division cycle 5-like; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6305208
• Gene: Cdc5l Location: Chr17:45702809-45744633 bp, - strand Genetic Position: Chr17, 22.36 cM
• Alliance: Cdc5l^em1(IMPC)J page
• IMPC: Cdc5l gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTCTGTCAGTGGTTATTCG and ATTGCTTCCCGTGAATAAAA, which resulted in a 344 bp deletion beginning at Chromosome 17 position 45,425,670 bp and ending after 45,426,141 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000389518 (exon 4) and 344 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acid 104. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cdc5l Mutation: 74 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)