U2surp^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: U2surp^em1(IMPC)J
• Name: U2 snRNP-associated SURP domain containing; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6306472
• Gene: U2surp Location: Chr9:95338951-95394049 bp, - strand Genetic Position: Chr9, 50.11 cM, cytoband E4
• Alliance: U2surp^em1(IMPC)J page
• IMPC: U2surp gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTGTTATCACATTATCCAA and GTTACACAAGAACTGCTGTT, which resulted in a 189 bp deletion beginning at Chromosome 9 position 95,493,667 bp and ending after 95,493,855 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000219474 (exon 5) and 74 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 107 and early truncation 38 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any U2surp Mutation: 72 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)