Lin52^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lin52^em1(IMPC)J
• Name: lin-52 DREAM MuvB core complex component; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6306929
• Synonyms: Lin52^-
• Gene: Lin52 Location: Chr12:84498196-84592919 bp, + strand Genetic Position: Chr12, 39.22 cM
• Alliance: Lin52^em1(IMPC)J page
• IMPC: Lin52 gene page

Lin52^em1(IMPC)J/Lin52^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but no embryos seen at E7.5. Blastocysts grown in vitro hatch from the zona pellucida and form outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTTGAGATTGCAGTTTGCC and CCTCTTTTTCGACTTGGTTT, which resulted in a 212 bp deletion beginning at Chromosome 12 position 84,459,515 bp and ending after 84,459,726 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000753116 (exon 4) and 145 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 48 and early truncation 9 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Lin52 Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)