Avl9^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Avl9^em1(IMPC)J
• Name: AVL9 cell migration associated; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6307018
• Gene: Avl9 Location: Chr6:56691884-56738897 bp, + strand Genetic Position: Chr6, 27.72 cM, cytoband C1
• Alliance: Avl9^em1(IMPC)J page
• IMPC: Avl9 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGACCCTTTAAATCAGCT and TCTGGGCAGGAGGGAGCCGA, which resulted in a 786 bp deletion beginning at Chromosome 6 position 56,723,008 bp and ending after 56,723,793 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001208835 (exon 2) and 665 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 30 and early truncation 31 amino acids later. There is a single bp (T) insertion at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Avl9 Mutation: 53 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)