Cfdp1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cfdp1^em1(IMPC)J
• Name: craniofacial development protein 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6307726
• Gene: Cfdp1 Location: Chr8:112495123-112580923 bp, - strand Genetic Position: Chr8, 57.98 cM
• Alliance: Cfdp1^em1(IMPC)J page
• IMPC: Cfdp1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAAACAATAGGAAGCTCCCA and GAGGTGTGTAAGGTGATCCA, which resulted in a 348 bp deletion beginning at Chromosome 8 position 111,841,722 bp and ending after 111,842,069 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000214932 (exon 3) and 140 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause early truncation at amino acid 61. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cfdp1 Mutation: 121 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)