Akt3^em1Shzb
Endonuclease-mediated Allele Detail

Summary

• Symbol: Akt3^em1Shzb
• Name: thymoma viral proto-oncogene 3; endonuclease-mediated mutation 1, Bridget Shafit-Zagardo
• MGI ID: MGI:6313591
• Synonyms: Akt3^fl
• Gene: Akt3 Location: Chr1:176847639-177085769 bp, - strand Genetic Position: Chr1, 82.66 cM, cytoband H4-H6
• Alliance: Akt3^em1Shzb page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready)
• Mutation: Insertion
• Mutation details: CRISPR/cas9 endonuclease-mediated genome editing was used to insert a loxP site in intron 2 (GAGCCCATCTTCAGTCTGAC) and a second loxP site in intron 3 (CTTGCATGTTTAACTAGGGCTGG) of the gene. (J:278836)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Akt3 Mutation: 42 strains or lines available

References

• Original: J:278836 DuBois JC, et al., Akt3-Mediated Protection Against Inflammatory Demyelinating Disease. Front Immunol. 2019;10:1738
• All: 1 reference(s)