Dnajb14^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dnajb14^em1(IMPC)J
• Name: DnaJ heat shock protein family (Hsp40) member B14; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6314206
• Gene: Dnajb14 Location: Chr3:137572801-137619350 bp, + strand Genetic Position: Chr3, 63.94 cM
• Alliance: Dnajb14^em1(IMPC)J page
• IMPC: Dnajb14 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTTCTGGAGAGACTAAACA and ATATAGCACAGTTTAATAGA, which resulted in a 396 bp deletion beginning at Chromosome 3 position 137,885,162 bp and ending after 137,885,557 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001225953 (exon 2) and 224 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acids 45. There is an 8 bp insertion (TTCATAGC) at the deletion site and a single bp insertion (T) 11 bp before the deletion site. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dnajb14 Mutation: 20 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)