Dydc2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dydc2^em1(IMPC)J
• Name: DPY30 domain containing 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6314223
• Gene: Dydc2 Location: Chr14:40771074-40791165 bp, - strand Genetic Position: Chr14, 22.36 cM, cytoband C1
• Alliance: Dydc2^em1(IMPC)J page
• IMPC: Dydc2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTCAGCCTCTATCAGCCAG and AACTCGCTTTAGGAAAAGAA, which resulted in a 970 bp deletion beginning at Chromosome 14 position 41,061,848 bp and ending after 41,062,817 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000120891 and ENSMUSE00000120893 (exons 2 and 3) and 691 bp of flanking intronic sequence including the translation start, splice acceptor and donor and is predicted to generate a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dydc2 Mutation: 9 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)