About   Help   FAQ
Ttbk2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ttbk2em1(IMPC)J
Name: tau tubulin kinase 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6314594
Gene: Ttbk2  Location: Chr2:120563297-120681085 bp, - strand  Genetic Position: Chr2, 60.37 cM, cytoband F1
Alliance: Ttbk2em1(IMPC)J page
IMPC: Ttbk2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAGGGAAAGAGTAAATCAA and GACGGTTCCTTCAGAATCCA, which resulted in a 364 bp deletion beginning at Chromosome 2 position 120,760,099 bp and ending after 120,760,462 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001306611 (exon 11) and 206 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 343 and early truncation 17 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ttbk2 Mutation:  64 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory