Pla2g2a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pla2g2a^em1(IMPC)J
• Name: phospholipase A2, group IIA (platelets, synovial fluid); endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6314807
• Gene: Pla2g2a Location: Chr4:138559171-138562497 bp, + strand Genetic Position: Chr4, 70.57 cM
• Alliance: Pla2g2a^em1(IMPC)J page
• IMPC: Pla2g2a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTCCGTGTCCGTTTTCCCC and GCGTGTGTGTTCTCATAACT, which resulted in a 471 bp deletion beginning at Chromosome 4 position 138,834,740 bp and ending after 138,835,210 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000402801 (exon 6) and 37 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 98 and truncation 68 amino acids later by read through after exon 5. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Pla2g2a Mutation: 7 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)