Dnai4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dnai4^em1(IMPC)J
• Name: dynein axonemal intermediate chain 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6314811
• Gene: Dnai4 Location: Chr4:102895262-102971752 bp, - strand Genetic Position: Chr4, 47.28 cM
• Alliance: Dnai4^em1(IMPC)J page
• IMPC: Dnai4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTGGACGCATGAATCCAAA and TGTATTAGTAGTAAATACAG, which resulted in a 450 bp deletion beginning at Chromosome 4 position 103,096,547 bp and ending after 103,096,996 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001222873 (exon 3) and 265 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 76 and early truncation 15 amino acids later. There is a single bp (T) insertion 73 bp before the deletion. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dnai4 Mutation: 60 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)