Adora2a^em1(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Adora2a^em1(IMPC)H
• Name: adenosine A2a receptor; endonuclease-mediated mutation 1, Harwell
• MGI ID: MGI:6315517
• Gene: Adora2a Location: Chr10:75152711-75170618 bp, + strand Genetic Position: Chr10, 38.52 cM, cytoband B5.3
• Alliance: Adora2a^em1(IMPC)H page
• IMPC: Adora2a gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 4 guide sequences CCTGGTTCCGATACGGCATGCTG, ACGATGTATCTTTGGTAATGGGG, GAGTGAGAACGATGTATCTTTGG, CCGATACGGCATGCTGCCACTGT, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 3 strains available Cell Lines: 0 lines available
• Carrying any Adora2a Mutation: 40 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)